FASTA files

>X06054.1/711637
GGGCCCGUCGUCUAGCCUGGUUAGGACGCUGCCCUGACGCGGCAGAAAUCCUGGGUUCAAGUCCCAGCGGGCCCA

>X06054.1/711637
GGGCCCGUCGUCUAGCCUGGUUAGGACGCUGCCCUGACGCGGCAGAAAUCCUGGGUUCAAGUCCCAGCGGGCCCA
(((((((..((((..........)))).(((((.......))))).....(((((.......)))))))))))).

>X06054.1/711637
GGGCCCGUCGUCUAGCCUGGUUAGGACGCUGCCCUGACGCGGCAGAAAUCCUGGGUUCAAGUCCCAGCGGGCCCA
(((((((..((((..........)))).(((((.......))))).....(((((.......)))))))))))).
GGGGGGG::ddddssssssssssdddd:eeeeepppppppeeeee:::::eeeeepppppppeeeeeGGGGGGG:

>RNA_a
GCCUCAAAGUAUAUGGAAGAGUAAGCCUUCCAUCCGCCUACUAGUUAGAGUGACUAAAGCCGACCGAC
>RNA_b
GAUCGUAUGGAAGAGUAAGCCUUCCAUUUCAAUCUUCUCGCUGUCUAUAGUUAAGCUCCGCGUCGCGCUAGGCA
>RNA_c
GUUCUACCAGCGCCGUACGGUGUCCAGGGGGUAGGAAAAGCGGGACGUACUUCAUAGGAUCAUUU
>RNA_d
UCUGAAGGCCGCACAUCAAUGCACAUGGAAGAGUAAGCCUUCCAUUGCGGGUGCCGUACGCAUGUGACAUGCCUGC

				

BED files

				chr1	155851218	155851462
				chr1	171556083	171556327
				chr1	183100344	183100590
				chr3	198290264	198290508
				...		...		...
				

1. sorting, via bash sort
2. intersect with GTF, via bedtools intersect
3. selection of region, via awk scripting
4. extension of the reads, via bedtools slop
5. FASTA extraction, via bedtools getfasta

• Minimum Free Energy prediction method (RNAfold from Vienna Package, Lorenz et al., 2011)
or
• Maximum expected accuracy structure prediction (MaxExpect from RNAstructure Package, Bellaousov et al., 2013);

Advanced Options:

BEAM (BEArMotif finder) is a method that explores sets of unaligned RNAs sharing a biological property (e.g. the ability to bind a specific RNA-binding protein) looking for the best local secondary structure motifs, and evaluating their significance with respect to a common background. BEAM is able to identify structurally similar sites shared by hundreds or thousands of RNAs, and the extension of the motifs is not subject to limitations (other than those imposed by the user). Hence, it is a tool suitable for low- , medium- and high-throughput settings such as those in CLIP-seq analysis.

BEAM employs the BEAR secondary structure notation (Mattei et al. 2014) and its associated similarity matrix of secondary structure elements, in order to capture motifs by structural similarities that derive from evolutionary related ncRNAs in a way that covers topological comparison, yet expands it by considering the evolutionary history behind the abstraction of structure representation. BEAMfollows a heuristically tweaked simulated annealing algorithm to look for the system state A having the best score BS(A).Given N BEAR-encoded RNA secondary structures, a random initial state is drawn. From there, and for a fixed maximum number of steps (or until score con- vergence), a random perturbation is drawn from a uniform distribution (a flowchart is shown in the figure below).

Every motif is reported as its PFM and its consensus, using for clarity a simplified version of the BEAR alphabet denoted as qBEAR(quick BEAR), and its significance is evaluated on a background distribution

For more information and algorithm details see

How to interpret a qBEAR logo:

We are all accustomed to reading a sequence Logo, but with the advent of the new RNA structural alphabet (BEAR), several new visualizations are made possible, and this is a guide to interpret one of those.

The first thing to remember is that qBEAR is not BEAR, but its simplification. It is only a visual escamotage used to simplify an otherwise fuzzy logo output. The way to remember how qBEAR works is by visualizing a keyboard: every column is a structural element, divided in three groups of lengths (when appliable).

The three groups are divided in short, medium and long for the structural elements that allow it. Bulges and unpaired branching are defined by only one character each.

Colors are used to better distinguish class differences. Same color = Same structural class (possible different lengths).

Now for a practical example:

In terms of 2D secondary structures plots this ambiguity has no way to be resolved but to plot the different possible structures. A method that actually prints all the possible structures in one place would be necessary.

The full set of options used with weblogo is:

Should you need to use the integrated folding methods of this web server, please take into account a longer processing time and stricter limits. The time needed for BEAM in standard conditions (motif width 10-40nt, 3 motifs), as reported in (Pietrosanto et al., 2016), is generally lower than the folding time (this is true especially for RNAstructure).

The following plots show how much time do RNAfold and RNAstructure take to fold sets of 1k to 100k RNA sequences of different length (up to 2000nt). With dashed lines the time needed to BEAM to process the data and return 3 motifs.